Subject: Biological Information Theory and Chowder Society FAQ
Summary: monthly Frequently Asked Questions posting for BITCS
 The news group bionet.info-theory is a forum for discussing information theory
 in biology and for tossing food for thought around.  Other interesting
 mathematical problems in biology are also welcome, as we will try our best to
 take the log of them, so as to convert them into information theory problems.
Nntp-Posting-Host: fcsparc6.ncifcrf.gov
Date: Fri, 28 Jul 1995 17:58:04 GMT


***********************************************************

Replies to Frequently Asked Questions (FAQ) for bionet.info-theory

             Biological Information Theory and Chowder Society

version = 1.81 of bionet.info-theory.faq  1995 July 20

***********************************************************
|-| What is Information Theory?
|-| What is the History of The Biological Information Theory and Chowder Society?
|-| What Kind of Questions Are Appropriate For Discussion?
|-| Is There a Quick Introduction to Information Theory Somewhere?
|-| I'm Confused: How Could Information Equal Entropy?
|-| How Can I Learn More About Information Theory and Biology?  References
|-| Where Can I Get BIG Coins?
|-| Will Authors Send Me Papers?
|-| How Do I find Sequence Logos on the Web?
|-| Is There a Shell Script for Making Sequence Logos?
|-| Is There a World Wide Web Page for Making Sequence Logos?
|-| Can You Point My WWW Browser To The FAQ And The Archives?
|-| How Do I obtain bionet.info-theory BY EMAIL?
|-| Where Did I Get This FAQ File From Originally?
|-| What is the IP number of the FAQ archive?
|-| Where Are the Bionet Archives?
|-| What Can I Do About Inappropriate Postings?
|-| What is the official word on copyright of this FAQ?
|-| Who Takes Care of This Group?
|-|
***********************************************************

|-| What is Information Theory?

Information theory is a branch of mathematics concerned with the process of
making choices.  Although it has a rich history going back centuries, it was
the work of Claude Shannon, published in 1948 and later, which started the
field.  The theory is powerful and has resulted in great achievements.  The
beautiful sound we enjoy from compact disks (CD's) became possible only because
of Shannon's work.  The bionet.info-theory news group was formed to discuss the
many applications of information theory to biology.  (It is not a general
information news group as some might be mislead to think.)  It is worth at
least some of your time to see why we are so excited about this application, as
it could turn your research around by sharpening your experimental approaches.

***Newcomers please note: this newsgroup is NOT an appropriate forum for
persons seeking information about any question related to biology or medicine!
This newsgroup is devoted to DISCUSSIONS ABOUT BIOLOGICAL APPLICATIONS OF
INFORMATION THEORY, principally referring to Shannon's theory of information,
although we also discuss the mathematical and physical meaning of entropy,
alternative definitions of information, and related foundational issues in
information theory.***

***********************************************************

|-| What is the History of The Biological Information Theory and Chowder Society?

The Biological Information Theory and Chowder Society (BITCS) is a group of
scientists interested in the biological applications of information theory
(thus the "BIT") who meet informally for dinner (thus the "CS") from time to
time in the Washington, DC, area.  At our dinners we have only one rule ---
food fights are discouraged.

The guys who started this thing did it because we weren't certain we understood
the biological implications of information theory.  Some of us are more
comfortable with the mathematical machinery and assemble biological systems
into grand canonical ensembles whether they want to be there or not; and some
of us think they understand what the biological systems are doing but can't
take a log to base 2.  What we try to do is pry from one another the bits of
knowledge that will help us understand what's going on.

Some of the topics up for discussion in our group are:

* biological applications of information theory
* biochemical molecular machines and computers
* computer methods for recognition of molecular structure and function
* database organization for biomolecular information
* nanotechnology
* the limits of computation
* "dissipationless" (?) computation
* Maxwell's demon
* anecdotes and humor about all these topics
* methods and theories of molecular computation

A few relevant papers are listed below.

The group started when Tom Schneider was introduced to John Spouge in 1988.
Tom bounced his ideas about molecular machines off John, and John kept finding
flaws.  Tom would go away rather unhappily for a month and then find a
solution.  But John was always one step ahead...  (and still is, on last
account.)  Tom gave a talk about molecular machines at the Lambda Lunch meeting
on the Bethesda NIH campus, and John introduced John (Steve) Garavelli.  We all
got together with Peter Basser for dinner once in a while to talk about
information theory.  Steve brought in one of the first people to apply
information theory to biology, Hubert Yockey.  Steve Garavelli dubbed the group
the "Biological Information Theory and Chowder Society", which it is still
called.  We are known sometimes as 'chowderheads', and talk about food fights,
but so far have only had electronic food fights!  We hold dinners in Bethesda
Maryland on random occasions.

When our informal mailing list became difficult to handle, we petitioned to
start a bionet news group.  We hope to hold roaring discussions, and everyone
is welcome to join.  If you are uncertain about something, quit lurking and ask
on the net.  It may well be that what bothered you is the key to a new piece of
information theory in biology.  (The major advances so far have been by things
that REALLY bugged people.)

We will also announce when and where our (irregular) eatings are and you are
welcome to join if the travel is not too far.  John Spouge
(spouge@ncbi.nlm.nih.gov), usually makes the arrangements.  If you would like
to give a talk to the group, contact us to make arrangements.  (Our addresses
are at the end of this faq.)

***********************************************************

|-| What Kind of Questions Are Appropriate For Discussion?

This faq sheet answers simple questions about this group.  The BIG questions
should be discussed on the net, where we can all haggle over them.  Here are a
few for starters:

What is the role of theory in biology today?
What should be the role of biological theory?

What is information?  How should it be defined?

What bothers you when you read the two papers on the theory of molecular
machines?  (It is only from the things that bother us that we can make progress
in understanding.)  (See references below.)

What are flaws in the theory of molecular machines?

How is ATP used to drive molecular machines?

All communication systems are associated with living things, so is it true that
information theory is really a theory about living things?  Was Shannon really
a great biologist?

What does Maxwell's Demon have to do with all of this?

What are the limits of computers?

What are the limits of nanotechnology?

Can we build molecular computers and how would they work?

***********************************************************

|-| Is There a Quick Introduction to Information Theory Somewhere?

See the primer on information theory:
ftp://ftp.ncifcrf.gov/pub/delila/primer.ps

***********************************************************

|-| I'm Confused: How Could Information Equal Entropy?

If someone says that information = uncertainty = entropy, then they are
confused, or something was not stated that should have been.  Those equalities   
lead to a contradiction, since entropy of a system increases as the system   
becomes more disordered.  So information corresponds to disorder according to
this confusion.
 
If you always take information to be a decrease in uncertainty at the receiver
and you will get straightened out:

R = Hbefore - Hafter.

where H is the Shannon uncertainty:

H = - sum (from i = 1 to number of symbols) Pi log2 Pi (bits per symbol)

and Pi is the probability of the ith symbol.  If you don't understand this,
please refer to "Is There a Quick Introduction to Information Theory
Somewhere?".

Imagine that we are in communication and that we have agreed on an alphabet.
Before I send you a bunch of characters, you are uncertain (Hbefore) as to what
I'm about to send.  After you receive a character, your uncertainty goes down
(to Hafter).  Hafter is never zero because of noise in the communication
system.  Your decrease in uncertainty is the information (R) that you gain.

Since Hbefore and Hafter are state functions, this makes R a function of
state.  It allows you to lose information (it's called forgetting).  You can
put information into a computer and then remove it in a cycle.

Many of the statements in the early literature assumed a noisess channel, so
the uncertainty after receipt is zero (Hafter=0).  This leads to to the SPECIAL
CASE where R = Hbefore.  But Hbefore is NOT "the uncertainty", it is the
uncertainty of the receiver BEFORE RECEIVING THE MESSAGE.

A way to see this is to work out the information in a bunch of DNA binding
sites.  Here is an aligned listing of the binding sites for the cI and cro
proteins of the bacteriophage (ie, virus) named lambda:

alist 5.21 aligned listing of:
* 92/10/04 23:17:10, 91/02/05 15:07:18, lambda.ci.cro
The book is from:   0 to 0
This alist list is from: -30 to 30
The alignment is by delila instructions

     ---------------------                   +++++++++++++++++++++
     322222222221111111111--------- +++++++++111111111122222222223
     0987654321098765432109876543210123456789012345678901234567890
     .............................................................
   1 tgcgtcctgctgatgtgctcagtatcaccgccagtggtatttatgtcaacaccgccagaga
   2 tctctggcggtgttgacataaataccactggcggtgatactgagcacatcagcaggacgca
   3 tcaccgccagtggtatttatgtcaacaccgccagagataatttatcaccgcagatggttat
   4 ataaccatctgcggtgataaattatctctggcggtgttgacataaataccactggcggtga
   5 gtcaacaccgccagagataatttatcaccgcagatggttatctgtatgttttttatatgaa
   6 ttcatataaaaaacatacagataaccatctgcggtgataaattatctctggcggtgttgac
   7 ttttgtgctcatacgttaaatctatcaccgcaagggataaatatctaacaccgtgcgtgtt
   8 aacacgcacggtgttagatatttatcccttgcggtgatagatttaacgtatgagcacaaaa
   9 atcaccgcaagggataaatatctaacaccgtgcgtgttgactattttacctctggcggtga
  10 tcaccgccagaggtaaaatagtcaacacgcacggtgttagatatttatcccttgcggtgat
  11 acaccgtgcgtgttgactattttacctctggcggtgataatggttgcatgtactaaggagg
  12 cctccttagtacatgcaaccattatcaccgccagaggtaaaatagtcaacacgcacggtgt
                                          ^

Read the numbers on the top vertically.  This is called a "numbar".  Notice
that position +7 always has a T (marked with the ^).  That is, according to
this rather limited data set, one or both of the proteins that bind here always
require a T at that spot.  Since the frequency of T is 1 and the frequencies of
other bases there are 0, H(+7) = 0 bits.  But that makes no sense whatsoever!
This is a position where the protein requires information to be there.  That
is, what is really happeneing is that the protein has two states.  In the
BEFORE state, it is somewhere on the DNA, and is able to probe all 4 possible
bases.  Thus the uncertainty before binding is Hbefore = log2(4) = 2 bits.  In
the AFTER state, the protein has bound and the uncertainty is lower:
Hafter(+7) = 0 bits.  The information content, or sequence conservation, of the
position is Rsequence(+7) = Hbefore - Hafter = 2 bits.  That is a sensible
answer.  Notice that this gives Rsequence close to zero outside the sites.

If you have uncertainty and information and entropy confused, I don't think you
would be able to work through this problem.  For one thing, one would get high
information OUTSIDE the sites.  Some people have published graphs like this.

A nice way to display binding site data so you can see them and grasp their
meaning rapidly is by the sequence logo method.

***********************************************************

|-| How Can I Learn More About Information Theory and Biology?  References

REFERENCES - General

There are a huge number of papers related to this topic, just about everything
in molecular biology, lots of chemistry, physics, electronics, evolutionary
theory, thermodynamics, statistical mechanics and the kitchen sink ...  You can
get a pretty good overview by combining the references of Schneider.ccmm,
Schneider.edmm and Leff1990.  References are given in BiBTeX format, the
bibliography program associated with LaTeX, the powerful and portable
typesetting program.

By arrangement, books that have prices listed can be ordered over Internet from:
  Reiter's Scientific & Professional Books
  2021 K Street, NW
  Washington, DC  20006
  1-800-537-4314
  1-202-223-3327
  1-202-296-9103 FAX
  books@reiters.com

Shipping and handling charges are:
in the DC metropolitan area $4.00 for one item, $0.50 for each additional item,
outside the area $4.50 for one item, $0.50 for each additional item.

The prices are current as of October 1994; because publishers are constantly
changing their prices, they should be considered estimates rather than
guaranteed prices.  To open an account you must first either phone or FAX them
and provide a credit card number.  Book orders can be then placed at any time
over the Internet.
        **DO NOT SEND CREDIT CARD NUMBERS OVER THE INTERNET!**

Reiter's carries all of the books on this list except "Information Theory:
Saving Bits", and that one can be special ordered.  If enough interest in this
book is generated by the FAQ, it will be added as regular stock.  (It can also
be ordered directly from the company using the information given.)

# Gonick's Wonderful books (Don't be shy!  They are worth the money!!):

@book{Gonick.computers,
author = "L. Gonick",
title = "The Cartoon Guide to Computers",
edition = "second",
publisher = "HarperCollins",
address = "New York, NY",
isbn = "0-06-273097-5",
price = "price as of 1994 October 31: \$11.00",
year = "1991"}

@book{Gonick.genetics,
author = "L. Gonick",
title = "The Cartoon Guide to Genetics",
edition = "updated",
publisher = "Barnes \& Nobel",
address = "New York, NY",
isbn = "0-06-273099-1",
price = "price as of 1994 October 31: \$12.00",
year = "1991"}

@book{Gonick.physics,
author = "L. Gonick
 and A. Huffman",
title = "The Cartoon Guide to Physics",
publisher = "HarperPerennial",
address = "New York, NY",
isbn = "0-06-273100-9",
price = "price as of 1994 October 31: \$12.00",
year = "1990"}

# A good starting point if you don't know much molecular biology:
# (Two volumes)

@book{Watson1987,
author = "J. D. Watson
 and N. H. Hopkins
 and J. W. Roberts
 and J. A. Steitz
 and A. M. Weiner",
title = "Molecular Biology of the Gene",
edition = "fourth",
publisher = "The Benjamin/Cummings Publishing Co., Inc.",
address = "Menlo Park, California",
isbn = "0-8053-9614-4",
price = "price as of 1994 October 31: \$59.95",
year = "1987"}

# This book describes LaTex and BiBTeX:

@book{Lamport1994,
author = "L. Lamport",
title = "\LaTeX: A Document Preparation System,
User's Guide \& Reference Manual",
edition = "second",
publisher = "Addison-Wesley Publishing Company",
address = "Reading, Massachusetts",
isbn = "0-201-52983-1",
price = "price as of 1994 October 31: \$32.95",
year = "1994"}

# ***********************************************************
# REFERENCES - Information Theory

# The best starter book:

@book{Pierce1980,
author = "J. R. Pierce",
title = "An Introduction to Information Theory:
Symbols, Signals and Noise",
edition = "second",
publisher = "Dover Publications, Inc.",
address = "New York",
isbn = "0-486-24061-4",
comment = "
original copyright 1961
Ordering information:  Pierce1980 is currently available by mail from:
   Dover Publications, Inc.
   31 East 2nd street
   Mineola, New York 11501
order:
   Pierce, An Introduction to Information Theory: Symbols, Signals and Noise
   code number: 24061-4
$7.95 + charges.  Payment in full, no telephone or credit card orders.
Postage and Handling charges are:
Bookrate: $3 (US only)
UPS: $4.50 (US only, not Alaska or Hawaii or PO boxes)
Foreign orders: add 20% of total (minimum $2.50)
Sales Tax (Ny residents only)
Foreign Orders Note: Remittances must be sent by international money order or
in U.S. funds via Federal Wire System to Chemical Bank, N. Y.  ABA #021000128.
Mark all remittances `For the account of Dover Publications, Inc.  #001 053
272'.  This information is from the Dover Math and Science Catalogue 9/92",
price = "price as of 1994 October 31: \$8.95",
year = "1980"}

Christopher Hillman (hillman@math.washington.edu) suggests that this one is a
better starting point:  Thomas Cover and Joy A. Thomas, Elements of Information
Theory, Wiley, 1991.  People who have seen both could post their opinions.

# A good introduction to the mathematics:

@book{Sacco1988,
author = "W. Sacco
 and W. Copes
 and C. Sloyer
 and R. Stark",
title = "Information Theory: Saving Bits",
publisher = "Janson Publications, Inc.",
comment = "original address was Providence, Rhode Island",
address = "Dedham, MA",
isbn = "0-939765-25-X",
phone = "(800) 322-6284",
price = "price as of 1994 October 31: \$11.95",
year = "1988"}

# Important originals:

@article{Shannon1948,
author = "C. E. Shannon",
title = "A Mathematical Theory of Communication",
year = "1948",
journal = "Bell System Tech. J.",
volume = "27",
pages = "379-423, 623-656"}

@book{ShannonWeaver1949,
author = "C. E. Shannon
 and W. Weaver",
title = "The Mathematical Theory of Communication",
publisher = "University of Illinois Press",
address = "Urbana",
isbn = "0-252-72548-4",
price = "price as of 1994 October 31: \$9.95",
year = "1949"}

@article{Shannon1949,
author = "C. E. Shannon",
title = "Communication in the Presence of Noise",
year = "1949",
journal = "Proc. IRE",
volume = "37",
pages = "10-21"}

# For the committed: The Complete Works!

@inproceedings{Shannon1993,
author = "C. E. Shannon",
editor = "N. J. A. Sloane and A. D. Wyner",
booktitle = "Claude Elwood Shannon: Collected Papers",
publisher = "IEEE Press",
address = "Piscataway, NJ",
isbn = "0-7803-0434-9",
comment = "IEEE Order Number: PC0331-9
  To order directly by charge card (eg Visa works) you can call
  (908)-981-0060
  $69.95 + $5 handling charge
  delivery in about 2 weeks",
price = "price as of 1994 October 31: \$69.95",
year = "1993"}

# How locks work and other cool stuff:

@book{Macaulay1988,
author = "D. Macaulay",
title = "The Way Things Work",
publisher = "Houghton Mifflin Company",
address = "Boston",
isbn = "0-395-42857-2",
price = "price as of 1994 October 31: \$29.95",
comment = "This book is also available on Windows-Compatible CD-ROM
  cdrom isbn = 1-56458-901-3  Price as of 1994 October 31: \$99.95",
year = "1988"}

# Leff1990 gives a review of the Maxwell's Demon problem.
# See also Schneider.edmm, listed below.

@book{Leff1990,
author = "H. S. Leff and A. F. Rex",
title = "Maxwell's Demon: Entropy, Information, Computing",
publisher = "Princeton University Press",
address = "Princeton, N. J.",
phone = "1(800) 777-4726",
isbn.hard = "0-691-08726-1 (hard cover)",
price.hard = "price as of 1994 October 31: \$80.00",
isbn.paper = "0-691-08727-X (paperback)",
price.paper = "price as of 1994 October 31: \$26.95",
year = "1990"}

# ***********************************************************

# REFERENCES - Jaynes

@article{JaynesI,
  author = "Edwin T. Jaynes",
  title = "Information Theory and Statistical Mechanics",
  year = 1957,
  journal = "Physical Review",
  volume = "106",
  pages = "620-630"}

@article{JaynesII,
  author = "Edwin T. Jaynes",
  title = "Information Theory and Statistical Mechanics. {II}",
  year = 1957,
  journal = "Physical Review",
  volume = "108",
  pages = "171-190"}

# A version of Jaynes' new book "PROBABILITY THEORY -- THE LOGIC OF SCIENCE"
# is available on the net.  See:
#
# ftp://bayes.wustl.edu/Jaynes.book/
# Larry Bretthorst (larry@bayes.wustl.edu)
#
# http://omega.albany.edu:8008/JaynesBook.html
# Carlos Rodriguez (carlos@math.albany.edu)
#
# Tom Schneider's pointers to these places:
# http://www-lmmb.ncifcrf.gov/~toms/jaynes.html
#
# Note:  The book is being written now and new versions come out every once in a
# while.  One of these locations may be more up to date than the other.

# ***********************************************************
# REFERENCES - Schneider

@article{Schneider1986,
author = "T. D. Schneider
 and G. D. Stormo
 and L. Gold
 and A. Ehrenfeucht",
title = "Information content of binding sites on nucleotide sequences",
journal = "J. Mol. Biol.",
volume = "188",
pages = "415-431",
year = "1986"}

@inproceedings{Schneider1988,
author = "T. D. Schneider",
editor = "G. J. Erickson and C. R. Smith",
title = "Information and entropy of patterns in genetic switches",
booktitle = "Maximum-Entropy and Bayesian Methods in Science and Engineering",
volume = "2",
pages = "147-154",
publisher = "Kluwer Academic Publishers",
address = "Dordrecht, The Netherlands",
year = "1988"}

@article{Schneider1989,
author = "T. D. Schneider
 and G. D. Stormo",
title = "Excess Information at Bacteriophage {T7} Genomic Promoters
Detected by a Random Cloning Technique",
year = "1989",
journal = "Nucl. Acids Res.",
volume = "17",
pages = "659-674"}

@article{Schneider.Stephens.Logo,
author = "T. D. Schneider
 and R. M. Stephens",
title = "Sequence Logos: A New Way to Display Consensus Sequences",
journal = "Nucl. Acids Res.",
volume = "18",
pages = "6097-6100",
year = "1990"}

@article{Schneider.ccmm,
author = "T. D. Schneider",
title = "Theory of Molecular Machines.
{I. Channel} Capacity of Molecular Machines",
journal = "J. Theor. Biol.",
volume = "148",
number = "1",
pages = "83-123",
note = "{(Note: The figures were printed out of order!
Fig. 1 is on p. 97.)}",
year = 1991}

@article{Schneider.edmm,
author = "T. D. Schneider",
title = "Theory of Molecular Machines.
{II. Energy} Dissipation from Molecular Machines",
journal = "J. Theor. Biol.",
volume = "148",
number = "1",
pages = "125-137",
year = 1991}

@article{Herman.Schneider1992,
author = "N. D. Herman
  and T. D. Schneider",
title = "High Information Conservation Implies that at Least Three Proteins
Bind Independently to {F} Plasmid {{\em incD\/}} Repeats",
journal = "J. Bact.",
volume = "174",
pages = "3558-3560",
year = "1992"}

@article{Stephens.Schneider.Splice,
author = "R. M. Stephens
  and T. D. Schneider",
title = "Features of spliceosome evolution and function
inferred from an analysis of the information at human splice sites",
journal = "J. Mol. Biol.",
volume = "228",
pages = "1124-1136",
year = "1992"}

@article{Papp.helixrepa,
author = "P. P. Papp
 and D. K. Chattoraj
 and T. D. Schneider",
title = "Information Analysis of Sequences that Bind
the Replication Initiator {RepA}",
journal = "J. Mol. Biol.",
comment = "Cover of 233, number 2!",
volume = "233",
pages = "219-230",
year = "1993"}

@article{Schneider.nano2,
author = "T. D. Schneider",
title = "Sequence Logos, Machine/Channel Capacity,
{Maxwell}'s Demon, and Molecular Computers:
a Review of the Theory of Molecular Machines",
journal = "Nanotechnology",
volume = "5",
number = "1",
pages = "1-18",
year = "1994"}
ftp://ftp.ncifcrf.gov/pub/delila/nano2.ps

# ***********************************************************
# REFERENCES - Yockey

@book{Yockey1958a,
editor = "Hubert P. Yockey and Robert P. Platzman and Henry Quastler",
title = "Symposium on Information Theory in Biology",
booktitle = "Symposium on Information Theory in Biology",
publisher = "Pergamon Press",
address = "New York, London",
comment = "out of print",
year = "1958"}

@article{Yockey1981,
author = "Hubert P. Yockey",
year = 1981,
title = "Self-organization Origin of Life Scenarios and Information Theory",
journal = "J. Theor. Biol.",
volume = "91",
pages = "13-31"}

@book{Yockey1992,
author = "H. P. Yockey",
title = "Information Theory in Molecular Biology",
publisher = "Cambridge University Press",
address = "Cambridge",
isbn = "0-521-35005-0",
comment = "40 West 20th Street,
New York, N. Y.  10011-4211,
order number 350050",
phone = "1-800-827-7423",
price = "price as of 1994 October 31: \$74.95",
year = "1992"}

Following is Hubert Yockey's reference list:

Yockey, Hubert P. Information Theory and Molecular Biology, Cambridge UK:
Cambridge University Press (1992)
When is random random? Nature 344 (1990) p823, Hubert P. Yockey
Yockey, Hubert P. (1981). Self-organization origin of life scenarios and
information theory. Journal of Theoretical Biology, 91, 13-31.
Yockey, Hubert P. (1979). Do overlapping genes violoate molecular biology and
the theory of evolution? Journal of Theoretical Biology, 80, 21-26.
Yockey, Hubert P. (1978). Can the Central Dogma be derived from information
theory? Journal of Theoretical Biology, 74, 149-152.
Yockey, Hubert P. (1977a). A prescription which predicts functionally
equivalent residues at given sites in protein sequences. 67, 337-343.
Yockey, Hubert P. (1977b). On the information content of cytochrome c.
Journal of Theoretical Biology, 67, 345-376.
 Yockey, Hubert P. (1977c). A calculation of the probability of spontaneous
biogenesis by information theory. Journal of Theoretical Biology, 67,
377-398.
Yockey, Hubert P (1974). An application of information theory to the Central
Dogma and the sequence hypothesis. Journal of Theoretical Biology,.46,
369-406.
Yockey, Hubert P. (1960) The Use of Information Theory in Aging and Radiation
Damage In The Biology of Aging American Institute of Biological Sciences
Symposium No. 6 (160) pp338-347
Yockey, Hubert P., Platzman, Robert P. & Quastler, Henry, eds. (1958a).
Symposium on Information Theory in Biology, New York, London: Pergamon Press.
Yockey, Hubert P. (1958b). A study of aging, thermal killing and radiation
damage by information theory. In Symposium on Information Theory in Biology.
eds. Hubert P. Yockey, Robert Platzman & Henry Quastler, pp297-316. New York,
London: Pergamon Press.
Yockey, Hubert P. (1956). An application of information theory to the physics
of tissue damage. Radiation.Research, 5, 146-155.

# ***********************************************************
# REFERENCES - Adleman and papers related to molecular computation

@article{Adleman1994,
author = "Leonard M. Adleman",
title = "Molecular computation of solutions to combinatorial problems",
journal = "Science",
volume = "266",
pages = "1021-1024",
date = "November 11",
year = 1994}

@article{Baum1995,
author = "Eric B. Baum",
title = "Building an associative memory vastly larger that the brain",
journal = "Science",
volume = "268",
pages = "583-585",
date = "April 28",
year = 1995}

@article{Lipton1995,
author = "Richard J. Lipton",
title = "DNA solution of hard computational problems",
journal = "Science",
volume = "268",
pages = "542-545",
date = "April 28",
year = 1995}

@manuscript{Adleman1995,
author = "Leonard M. Adleman",
title = "On constructing a molecular computer",
note = "Available by anonymous ftp:
/pub/csinfo/papers/adleman/molecular_computer.ps on usc.edu",
year = 1995}

Other available manuscripts:

1. Dick Lipton of Princeton,
Speeding up computations via molecular biology. Draft.  Dec. 9, 1994.        
anonymous ftp://ftp.cs.princeton.edu/pub/people/rjl/bio.ps

2. Dan Boneh of Princeton has several manuscripts available at:
Breaking DES Using a Molecular Computer.
Authors: D. Boneh, C. Dunworth, R. Lipton
This paper contains the talk from the workshop.
http://www.cs.princeton.edu/~dabo/biocomp.html

On the Computational Power of DNA.
Authors: D. Boneh, C. Dunworth, R. Lipton, J. Sgall
This is a new paper which contains several results:
a. Shows how to solve the circuit satisfaction problem.
b. Shows how to solve optimization problems such as MAX-Clique without going
   through decision problems.
c. Shows how to evaluate predicates in the polynomial hirarchy.

Making DNA Computers Error Resistant.
Authors: D. Boneh, R. Lipton
This paper shows how to transform volume reducing DNA algorithms into algorithm
that are resistant to errors.

***********************************************************
|-| Where Can I Get BIG Coins?

BIG coins are nice for explaining that a bit represents the choice between two
equally likely possibilities.  News Emporium, Inc. (703) 661-3550 sells large
coins at Dulles International Airport.  If you find another source, please tell
Tom Schneider.

***********************************************************

|-| Will Authors Send Me Papers?

Tom Schneider will mail you copies of his papers.  Send your physical address
to him at toms@ncifcrf.gov.  Some papers are on line already, see also the
README file in the ftp archive ftp.ncifcrf.gov in pub/delila.

If you are willing to send out papers or have papers you would like listed
here, please contact Tom Schneider.

You can request them through the Wolrd Wide Web from the page:
http://www-lmmb.ncifcrf.gov/~toms/papers.html

***********************************************************

|-| How Do I find Sequence Logos on the Web?

http://www-lmmb.ncifcrf.gov/~toms/sequencelogo.html

***********************************************************

|-| Is There a Shell Script for Making Sequence Logos?

Yes, you will find the one Shmuel Pietrokovski wrote in the ftp archive
ftp.ncifcrf.gov in pub/delila/logoaid.  (Also available in
bioinformatics.weizmann.ac.il/pub/software/logoaid.)

***********************************************************

|-| Is There a World Wide Web Page for Making Sequence Logos?

Yes, Steve Brenner has done it!

http://www.bio.cam.ac.uk/seqlogo/

***********************************************************

|-| Can You Point My WWW Browser To The FAQ And The Archives?

This file and the postings may be obtained by World wide Web browsers such as
Mosaic and Netscape through the World Wide Web pages at:

<UL>
<LI> <A HREF="gopher://net.bio.net/11/BIOLOGICAL-INFORMATION-THEORY">
Gopher Link to BIOSCI Archive of All Postings.</A>
This archive contains the most recent postings
as separate documents.
<br>Location: net.bionet.net

<LI> <A HREF="ftp://net.bio.net/pub/BIOSCI/BIOLOGICAL-INFORMATION-THEORY">
BIOSCI Archive of Monthly Postings.</A>
This archive (currently) contains postings
from each month as a single document.
<br>Location: net.bionet.net

<LI> <A HREF="ftp://net.bio.net/pub/BIOSCI/bionet/info-theory">
These are the BIOSCI raw postings, just numbered.</A>
<br>Location: net.bionet.net

<LI> <A HREF="ftp://ftp.bio.indiana.edu/usenet/bionet/info-theory/">
Gopher link to Archive of Postings at IUBO.</A>
This archive contains individual postings.
Older postings are collected by the month as a single document.
There is an index for each month.
<br>Location: ftp.bio.indiana.edu

<LI> <A HREF="http://www.krl.caltech.edu/~brown/alife/news/">
Archive of Life Related Newsgroups</A>.
This is an incredibly nicely organized
HTML archive of links maintained by
<a href="http://www.krl.caltech.edu/~brown/">Titus Brown at Caltech</A>
(brown@krl.caltech.edu).
This archive contains individual postings.
Check it out!!
<br>Location: www.krl.caltech.edu
 
</UL>

The current version of these hypertext references is pointed to by:

http://www-lmmb.ncifcrf.gov/~toms/bitcs.html
 
***********************************************************

|-| How Do I obtain bionet.info-theory BY EMAIL?

If you have access to USENET news YOU DO NOT NEED AN E-MAIL SUBSCRIPTION!!  We
strongly encourage all interested users to explore getting USENET news at your
site.  It's MUCH easier on you than an e-mail subscription!  Please consult
your systems manager or contact biosci-help@net.bio.net for assistance if
needed.

The BIOSCI (email) name for the forum is BIO-INFO.

Depending on where you are, you have to do different things to subscribe or be
removed from the email subscription list:

SUBSCRIBING / UNSUBSCRIBING
   North or South America or Pacific Rim:
     Using the computer account in which you want to receive mail
     messages, please send an email message to the e-mail server at
     biosci-server@net.bio.net.  Leave the Subject: line blank.
     In the body of the message include the line

     subscribe bio-info

     to add yourself to the mailing list or

     unsubscribe bio-info

     to cancel an existing subscription.  If you need personal
     subscription assistance, please contact biosci-help@net.bio.net.

   Europe, Africa, and Central Asia:
.   Send a email message to the person at
      biosci@daresbury.ac.uk
   requesting a subscription or removal from the BIO-INFO forum.

SENDING OUT POSTINGS
Thereafter, address email messages for this forum to one of:

   North or South America or Pacific Rim:
      bio-info@net.bio.net

   Europe, Africa, and Central Asia:
      bio-info@daresbury.ac.uk

You can post to either of the above address if you want.  We only request that
you sign up at your local node in order to optimize the use of the network
resources for message distribution.

Do not send subscription requests to any of these addresses, or you will have
sent it to everybody on the planet (to your great embarrassment, and we will
drub you with food cake)!  Let me say that again:  please do not post requests
for subscription or being removed from the list to the list itself, that takes
up bandwidth all over the world!

If you have problems, contact the subscription site manager who you signed up
with.  If your problem is not resolved, please contact
biosci-help@net.bio.net.

DO NOT CONTACT TOM SCHNEIDER FOR SUBSCRIPTIONS OR UNSUBSCRIBING!

***********************************************************

|-| Where Did I Get This FAQ File From Originally?

The latest version of this FAQ is stored in the anonymous ftp archive
ftp.ncifcrf.gov in pub/delila under the name "bionet.info-theory.faq".
The URL is:
ftp://ftp.ncifcrf.gov/pub/delila/bionet.info-theory.faq

This file is posted monthly on news.answers and bionet.info-theory.

You can retrieve a copy of the FAQ by sending the command
      info bio-info
to biosci-server@net.bio.net.  It is possible that this version will be older
than the one in the FTP archive, so you should use this method only if you
cannot use FTP.

Please send questions and comments to: Tom Schneider (toms@ncifcrf.gov).

***********************************************************

|-| What is the IP number of the FAQ archive?

For ftp.ncifcrf.gov you can use 129.43.1.11

***********************************************************
|-| Where Are the Bionet Archives?

The entire collection of BIOSCI/bionet messages from inception are
available via the biosci.src WAIS source at net.bio.net.  Contact
biosci-help@net.bio.net for further help with accessing this WAIS source.

FTP archives of all the BIOSCI/bionet messages are available at net.bio.net
[134.172.2.69] in /pub/BIOSCI.  bionet.info-theory is in
pub/BIOSCI/BIOLOGICAL-INFORMATION-THEORY.  Files are in mailbox format, with
names of the form YYMM (YY=last 2 digits of the year, MM=cardinal number of the
month, zero padded).  The current months postings are in the file 'current'.
Contact biosci-help@net.bio.net for further help with or comments on the
archives.

All the bionet.* newsgroups, including info-theory, are also archived for
Gopher retrieval from the IUBIO Gopher hole and for anonymous ftp from
ftp.bio.indiana.edu, directory usenet/bionet/...

The archives can be accessed by gopher or ftp running under the World wide Web
browsers such as Mosaic and Netscape interface.  The URL (Universal Record
Locator) for gopher is:
   gopher://net.bio.net/11/BIOLOGICAL-INFORMATION-THEORY
This gives individual postings.  By ftp one can use:
   ftp://net.bio.net/pub/BIOSCI/BIOLOGICAL-INFORMATION-THEORY
Unfortunately this gives the entire month in a single document.

***********************************************************

|-| What Can I Do About Inappropriate Postings?

The short form of this news group's name, bio-info, can be a little confusing
to some people inexperienced in network communications or with little knowledge
of the discipline (if there is any :-) of biological information theory.  It
can and has been mistaken as a news group for general biological information.
Our readers should be aware that when such postings come to our attention, we
do attempt to inform, privately, the people who make these inappropriate
postings of the error of their ways and suggest alternative or more appropriate
venues.

Subjecting the writers of inappropriate posting to public excoriation is not a
good policy because the mistake is usually inadvertent and the follow-up
postings add further to the irritation of our regular readers.  When others
publicly reply to such posts in this news group, although they may think they
are being polite to the original poster, they are still annoying our regular
readers.  We suggest that a better policy for readers who do wish to reply to
inappropriate posts is to do so privately or to an appropriate news group.

For information about how to deal with intransigent cases, see:
http://math-www.uni-paderborn.de/~axel/blacklist.html

***********************************************************

|-| What is the official word on copyright of this FAQ?

This FAQ fits the description in the U. S. Copyright Act of a "United States
Government work".  It was written as a part of my official duties as Government
employee.  This means it cannot be copyrighted.  The article is freely
available without a copyright notice, and there are no restrictions on its use,
now or subsequently.  I retain no rights in the FAQ.

Thomas D. Schneider

***********************************************************

|-| Who Takes Care of This Group?

John S. Garavelli
Protein Information Resource
National Biomedical Research Foundation
Washington, DC  20007
garavelli@gunbrf.bitnet

Tom Schneider
National Cancer Institute
Laboratory of Mathematical Biology
Frederick, Maryland  21702-1201
toms@ncifcrf.gov
http://www-lmmb.ncifcrf.gov/~toms/

John L. Spouge
National Center for Biotechnology Information
National Library of Medicine
Bethesda, MD  20894
spouge@frodo.nlm.nih.gov

Please email comments and suggestions on this faq sheet to Tom.

John Garavelli (who also answers to "Steve" if you want to avoid confusion)
often organizes dinner speakers.

John Spouge often arranges dinner locations.

***********************************************************
